adrianmr590 adrianmr590

20-01-2023
Mathematics

contestada

Tell whether the ordered pairs are a solution of the system of linear inequalities

Pair 1: (-3, -1)
Pair 2: (1, 0.5)

Tell whether the ordered pairs are a solution of the system of linear inequalities Pair 1 3 1 Pair 2 1 05 class=

Respuesta :

Otras preguntas

In order to compensate for an expected future decline in the Japanese yen relative to the U.S. dollar, the interest rate in Japan must be ______ the interest ra

What explanation does granny give about why Nathan Jones insists on teasing Sophie

An elevator in an office building made the following moves: Up 7 floors, down 14 floors, up 6 floors, down 2 floors, up 9 floors, down 5 floors. If the elevator

Determine the standard form of the equation of the line that passes through (-6, 6) and (3, -2). A. -8x + 9y = -6 C. -8x -9y = 6 B. 8x + 9y = 6 D. 9x - 8y = 6

Imagine two planets, Planet A and Planet B, in a distant galaxy. Both planets have the same size but Planet A has more mass than Planet B. Two identical spacecr

The ratio of the profit, material cost and production labour is 5:7:13. If the material cost is 840 more than that of labour, find the total cost of producing t

Which of the folldwing is an irrational number?

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC

Answer the question below for brainliest

sea turtles are what kind of vertebrae