le6afrahkalinds le6afrahkalinds

19-03-2016
Mathematics

contestada

what is th smallest number that can be made using these digits 4278

Respuesta :

Аноним Аноним

19-03-2016

the smallest number would be 2,478

Answer Link

Otras preguntas

Green pigmented plastids that function in photosynthesis are called

Make M the subject of the expression T = WP [ M² - ( M-S)² ]

which tool is the best to use if a person wants to visually show the populations of 10 cities in texas? a. circle graph b. timeline c. line graph d. bar gra

According to Beverly Raphael, what percent of survivors of a disaster could benefit from PFA?

I do not understand :(

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC

Please help meeee > THANK YOU!!!!!

What is the correct tool to measure the volume of a cardboard box? A) Balance B)Metric ruler C)graduated cylinder D)thermometernever mind i got it

If the marginal damage caused by a certain type of pollution is $100 billion and the marginal cost of abatement is $180 billion, then:

Beech Soda, Inc. uses a perpetual inventory system. The company's beginning inventory of a particular product and its purchases during the month of January were