michelleperezmp58
michelleperezmp58 michelleperezmp58
  • 20-01-2019
  • Mathematics
contestada

I need this problem answered
13 x (-9 )

Respuesta :

vixxs345 vixxs345
  • 20-01-2019

Answer:-117

13*-9=-117

Step-by-step explanation:


Answer Link
alinakincsem
alinakincsem alinakincsem
  • 20-01-2019

Answer:

-117

Step-by-step explanation:

We are given the following expression and we are to find its product:

13 × (-9)

So we will solve this in the standard order of solving a mathematical expression, starting with the opening of brackets and then multiplying the terms.

= 13 × -9

= -117

Since, we have a negative sign with only one of the numbers, it will show in the final product too.

Answer Link

Otras preguntas

government is a powerful organization that impacts many aspects of our lives. what are the other three types of strong organizations?
How did king victor emmanuel help unify Italy?
what are the steps? I have to find the angle of XYZ by using trigonometry
Use the number line to solve -2+4
La obra de Julia de Burgos fue reconocida en Latinoamérica.cierto/falso
on the planet froph, there are 15 dubbles to every 3 vreels. if farmer quect has 50 dubbles on her elentire farm, how many vreels are on the farm?
For safety reasons, the angle a ladder makes with the ground should be no greater than 67°. Find the length to the nearest foot of the shortest ladder that will
How many ions are produced from a 14.3 g sample of calcium nitrate
surpluses drive market prices up; shortages drive them down. true or false
Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT