divinatrigos00164 divinatrigos00164

20-08-2020
Business

contestada

A market economy is regulated by the interactions between which two things?

A market economy is regulated by the interactions between which two things class=

Respuesta :

Anonymouslearner2007 Anonymouslearner2007

20-08-2020

Answer:

b is the answer

Explanation:

producers and consumers

Answer Link

Otras preguntas

what are other objects, that have a similar motion to a P wave and an S wave?

Predictive dialing Automatically dials outbound calls and forwards answered calls to an available agent.

1. Negate the following statements. As usual, push the negation as far into the statements as possible. (a) p→(q∧r). (b) Everybody needs somebody. 5. Use proof

a tort is a civil wrong, for which the law will provide a remedy to the plaintiff. most often the remedy is in the form of money damages.

Convert 3 pints into liters. Round your answer to the nearest hundredth

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

Memphis Wholesale Market applies the lower of cost or net realizable valuation to individual products and has collected the following data: Product A Product B

Which best states how the passage reflects the characteristics of a multimodal text Adapted from Former First Lady Jacqueline B. Kennedy Source: John F. Kenned

mr. yeo, age 60, has early-onset alzheimer's disease. generalizing from the text, if scientists examine his brain, they are least likely to find:

a nurse is performing a baseline assessment of a client's skin integrity. what are the priority assessments? select all that apply.