figueroamelany316 figueroamelany316

19-12-2020
Biology

contestada

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Respuesta :

raduoprea160 raduoprea160

19-12-2020

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer Link

Otras preguntas

an example of a number that is a rational number but not whole

I really need the answer please!!!!! Explain how an intelligence test could be biased?

Find the values of x and y. 3x - 5 5y - 4 y + 12

an indicator is a comprehensive analysis of critical information

Give the domain and range for the following situation: A person gets on a ride at an amusement park. The ride rises slowly and then quickly to its highest point

What is happening in the scene below the heavens in Disputa? a. The popes, bishops, and philosophers are anxious and are awaiting a union. b. The popes, bishops

What is the reason behind an atom being neutral?

In its last century, ending in 1807 the leading carriers of slaves in the transatlantic trade was?

what are the steps for the respiratory system?

A woman enters a home because she wants to steal all of the jewelry. While on her way there, she changes her mind about stealing the jewelry, but it starts pour