heyyitsmike heyyitsmike

19-01-2021
Advanced Placement (AP)

contestada

8. A good example of a monolingual country
would be
(A) Japan.
(B) Canada.
(C) Switzerland.
(D) South Africa.
(E) Turkey

Respuesta :

marianaespinoza2002 marianaespinoza2002

19-01-2021

The answer is most likely A)

Answer Link

Otras preguntas

Without his glasses, Isaac can see objects clearly only if they are less than 4.7 m from his eyes. Required: What focal length glasses worn 2.1 cmcm from his e

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC

Tim wants to find the area of the floor in a room. If the room is square with length and width 8, what expression with an exponent can he write to show the area

f(x)= -3x+7 what is f(-20)?

What magnetic field strength will allow the electrons to pass through without being deflected?

A trait that is adaptive spreads faster through sexually reproducing organisms. a) true b) false

I need help pleasee!!!!!

i need help with this please answer

The shape of the distribution of the time required to get an oil change at a 10 minute oil change facility is unknown. However, records indicate that the mean t

{ (-2, 4), (0, 2), (-1, 3), (4, -2) } The set of ordered pairs above: A mapping diagram has 2 boxes. Box 1 is labeled domain with entries negative 3, 4, negat