hdiaz931
hdiaz931 hdiaz931
  • 22-02-2017
  • Biology
contestada

Part 1: CCATAGCACGTTACAACGTGAAGGTAA
Convert it into RNA
List Amino Acids and do the same with
CCGTAGCATGTTACAACGCGAAGGCAC
thanks :3

Respuesta :

dana1321 dana1321
  • 23-02-2017
RNA--GGUAUCGUGCAAUGUUGCACUUCCAUU
Answer Link

Otras preguntas

Why do you think antinous treats odysseus as he does?
Bachelor’s degrees are typically earned in _____. a. 1-2 years b. 2-3 years c. 3-4 years d. 4-5 years
What is the length of EF?
Which type of data is BEST described by a discrete model? Temperatures in Alaska A student’s grade level Time I take to brush your teeth Amount of gas in a tan
Calculate how many mg is lethal to resident Arnold who weighs 45 kg and resident Harold who weighs 96 kg. The LD50 of lead is 450 mg/kg
Consider the graph of the quadratic function y = x2 – 3x – 40. What are the roots of the function?
Find two consecutive whole numbers that square root 30 lies between.
why did china end sea voyages and isolate itself after Yongle died
Evaluate the expression 11 c 4 =
while walking to the kitchen in the middle of the night jamal tripped over an object he could not see. witch part of the CNS sent a signal to help prevent jalam