Er6ikaAntaliah Er6ikaAntaliah

19-03-2017
Health

contestada

The ______ acts as the internal clock that controls sleep and waking cycle

Respuesta :

jabbs2091 jabbs2091

20-03-2017

The Pineal Gland acts as the internal clock that controls sleep and waking cycle.

Answer Link

gdjgkxggxidggdots gdjgkxggxidggdots

10-09-2021

b. pineal gland

Explanation:

just took it on edge

Answer Link

Otras preguntas

The Silk Road connected diverse regions, such as west Asia, south Asia, central Asia, northern Africa, and east Asia. It helped get access to .

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC

m+1/4d=7 solve for d

What are the characteristics of civilization?

A dearborn company has earning per share of $2.30, it paid a dividend of $1.60 per share, and the market price of the company's stock is $64 per share. The pric

conjugating the verbs ETRE and AVOIR in the present tense.

A box at rest on a ramp at an incline of 22°. The normal force on the box is 538 N

Find the mass of the lamina described by the inequalities, given that its density is rho(x, y) = xy. 0 ≤ x ≤ 2, 0 ≤ y ≤ 2

6=2(y+2) what does y equal ?

An engine causes a car to move 10 meters with a force of 100 N. The engine produces 10,000 J of energy. What is the efficiency of this engine?