marie48 marie48

16-08-2017
Mathematics

contestada

Points a b and c ate noncollinear so therefore they are noncoplanar

Respuesta :

dpthomas48 dpthomas48

16-08-2017

The answer to your question is skew lines

Answer Link

Otras preguntas

Does anyone know how to do this type of shape/figure

Can someone help me with this can’t come up with the right answer

Find the area of the composite shape

GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra

2 ) Find the simple interest on $860 deposited at an interest rate of 3.5% for 3 years A. $30.10. B. $301 C. $90.30 D. $77.40

First Choice Carpets is considering purchasing new weaving equipment costing $ 734 comma 000. The company's management has estimated that the equipment will ge

What is 2/5 + 2/3 equal to

On land, the adult frog has pulmonary respiration only.

during each cycle, the velocity v (in meters per second) of a robotic welding device is given by v=9t-2/9+t^2, where t is time in seconds. find the expression f

arithmetic sequence of 9, 209 409, 609 and what id the difference?