andrewgomez4life andrewgomez4life
  • 17-02-2020
  • History
contestada

Communists immediately took power in which of the following countries in 1945?
Group of answer choices

* Hungary

* Albania

* Romania

* Poland

Respuesta :

Dan103107 Dan103107
  • 17-02-2020

Answer:

poland

Explanation:

Answer Link

Otras preguntas

what iswhat is osmosis what is photosynthesis ​
A drag racing vehicle travels from 0 to 100 mph in 5 seconds north. What is the acceleration?
DUE ASAP AT 10:30 5 ( x - 1 ) = 28 - 6x A 3 B 7 C 10 D -7
Calculate the atoms of hydrogen in 52.0 g of H2O.
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
All you need is on the picture
10 increased by the quotient of a number and six is five
A study of population of 1200 frogs revealed that 12 out of every 180 frogs in the population have spots on there back based on the results if this study how ma
Native bumblebees live in grasslands and consume pollen and nectar from flowers. The bumblebees carry pollen from one plant to another. The bees pollinate most
Dequan is training for a marathon. He runs 20 miles every 4 days. What is the unit rate for Dequan?