cupcake3085 cupcake3085
  • 17-02-2020
  • Mathematics
contestada

Two complementary angles measure (2x+14) and (x+20) degrees.What is the value of x?

Respuesta :

altavistard
altavistard altavistard
  • 17-02-2020

Answer:

18.67 degrees

Step-by-step explanation:

(2x+14) and (x+20) degrees add up to 90 degrees if the two angles are complementary.

Thus, 2x + 14 + x + 20 = 90, and so 3x + 34 = 90.

Solving for x, we get, first, 3x = 56. and second, x = 18.67 degrees.

Answer Link

Otras preguntas

Define net force????????
x + 3 = 7........pls solve
After spending $43 on groceries and $19 on book, Mrs. Groom had $16 left. How much money did Mrs. Groom have to begin with?
how do you get the answer for 1 5 over 8 and decimal 1.625 PLZ HELP I WILL GIVE YOU 50 POINTS FOR THIS
Read the e-mail. In the interest of public safety, Griffin Avenue should have a traffic light installed. There have been many traffic accidents recently at Gri
at a softball game you can get a bratwurst for $4.50. you have $18 to spend. write and solve an inequality to determine the number of bratwursts you can buy. th
The slope of the graph of the equation y=2x-2 is 2. What is the y-intercept?
Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3
What significant challenge did cities face as a result of rapid industrialization in the 1800s?
You discover a new species of slime mold that has a spore and stalk consisting of many cells. which group does it belong with?