kishaedwards05 kishaedwards05
  • 18-03-2022
  • Biology
contestada

Define photsynthesis? Of class 10 cbce

Respuesta :

yaboucanon
yaboucanon yaboucanon
  • 18-03-2022
photosynthesis is the process of which producers,(plants) create there own food using sunlight, there food is in the form of sugar.
Answer Link

Otras preguntas

WILL GIVE BRAINLIEST Estimate the solution of the equation a(x) = b(x) IMAGE BELOW
Kendra washes windows in an office building. She washes 25 2 5 of the windows on Monday. She washes 13 1 3 of the windows on Tuesday. What fraction of the windo
Tonya saved $564 in one year.month, how much did Tonya save in two months ​
The path of a seat on a new Ferris wheel is modeled by: What is the maximum height a rider will experience?
I. Fill in the blanks in the sentences below, using the cues in parentheses. Conjugate verbs in parentheses, paying attention to person and tense. If you see an
Every person uses energy stored in the fat cells of their body. This stored energy is in the form of A.Chemical energy B.mechanical energy C.heat energy D.Nucle
Factor x- 4x' + 7x- 28 by grouping. What is the resulting expr O (- 4)(x + 7) O +4)(x - 7) O (x2-7)(x + 4) O +7)(x- 4)
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Although half of the moon is always illuminated, usually only a portion of the Illuminated side is visible from earth. The diagram below represents the relative
17gallons : 12quarts